Bio Engineer Archive

Thread: Armour Macros

Talthazar
Fri Jun 04, 2004 12:57 am
#27

BTW did I also mention that while you wait for your armour to equip, you're naked?


BTW, how is this a bad thing?


j/k



Brutir Llecc'Honep
Master Bio-engineer - Proprietor - Honep Industries - Kauri
Brutir - Master Bio-Engineer - Test Center
SWG Bio-engineer
JediMindslayer
Fri Jun 04, 2004 2:19 am
#28

All i can add is that they better have something to offset this before they implement this change.

as in: PUT IN THE CHANGE REQUIRING THIS before making me spend 2 minutes to change outfits all the damn time.

other than that, this is by far one of the more stupider things i have heard of...




GATCGATCGATCTCCCTTTCCTTTCAACGGCGGAAGTCATAATAAAGTAAGTGTTTCGGGTTGGGTCTAGAATGAGTATATC
AGATCTCCAGGAGGGAGCATTTCCATTAATGATCGGGTTATCGCCAATACCTCTAGTTATATATTACTCCATCGAGTGATCG
TTCAATACTCGATCGTAGACGTTAAGTCACGGAGTTTCTAGCACCAATTTCAATAATAGCTGAGGATACGAAGCAGCGAGGA
TAATTACCGGGAGGTATAGGATCGCCAAATAATCCTCTAGATTCTTACTCCTTTCCCTGGCGATCACCTAGATCGATCTCTA


Wokka
Fri Jun 04, 2004 10:19 am
#29






Akelan wrote:

Yet another silly idea from people that don't seem to know how to play the game, based on complaints from others that seem to think some play it too well.


Armor macros are nothing out of the ordinary, but people seem to think they are somehow being cheated if they cannot sneak up behind someone who is relaxing in a cantina or while crafting and blow them away while they are vulnerable. Waiting 10 seconds to be able to equip armor seems ludicrous, and I can't honestly imagine how the devs or others responsible for the decision could suggest it as much else. The next question arises as to whether you wait 10 seconds for each piece of armor, or 10 seconds before you can equip any armor. How does it work if you are partially armored (say, you have armor boots on.) Are you armored, and able to don the rest immediately, or are you unarmored if you are not wearing every piece possible. Are you penalized for another timer if after you wait the 10 seconds, it takes you 15 seconds more to put on the rest, and the timer takes effect again?


Naritus had, and perhaps still has, a bounty-hunter's guild, with player marks and bounties. If you did not have an armor macro, you had best not sign up as a mark, as you could not don armor or buff after the challenge was issued. You either spotted the BH first and got ready, or it was "come as you are" night at the local cloning center.


US Military training concentrates in part on being able to react quickly to a situation. Would we accept another country saying "you have to wait 15 seconds before firing, or you are not playing fair?"


If this makes it from Test to live, I will give it 2 days to be rescinded like the pet-trades, the "new and improved crafting system" and a number of other similar things that have been sad wastes of a developer's time, when there is so much more we really do need in the way of fixes and content. (I would give it one, but I am feeling unduly generous today, hehe)


LLan





And you'd be wrong. Of course there's going to be crying and gnashing of teeth but they're gonna keep the armor equip delays. How it works is very simple.


For each piece of armor you put on:

1) it removes the current clothing where the armor is going.

2) count to 6 (roughly)

3) you wear the armor piece.


If you're using a macro, you have to wait until all pieces are on before you can do ANYTHING. You can't sit, eat, drink, fart, say anything, call a pet, (wait I think you can call a pet which is independent from this timer) until the macro completes.


What I don't like is the period of nakedness while you wait. This sucked at first and now they made the naked period worse by lengthening it.


What this will prevent is the magic poof people do (power rangers move) when they become instantly armored. The way I see it, this introduces an element of surprise. I've seen too many people dress as noobs, talk smack to provoke a fight, then turn all power rangers with a weapon and full armor in seconds. That's not realistic or even sportsmanlike. So now, if you see your mark not wearing any armor, you'll have the element of surprise to take him down, but then again, if you know you're being hunted, don't take off your armor if you're gonna need it.


Picture this, you're a BH, and you see your Jedi mark, you click on your armor macro and he sees you too. While you are getting "dressed", he cuts you down in cold blood, or runs away, and you couldn't do a thing but watch because you weren't ready.


Wokka-wokka
Washell
Fri Jun 04, 2004 7:06 pm
#30

Brilliant change, even more composite clones running about because the quickie armor change gets "abused" in the little bit of PVP still going on.


Washell Olivaw, Ranger/Rifleman, Eclipse



Cango
Fri Jun 04, 2004 7:34 pm
#31

I love this change. Someone putting on a helmet,c hest peice, 2 bracers, 2 biceps, gloves, pants, and boots, faster in the game thatn i can put on a T-shirt in real life was just stupid.

Armor is overpowered at the moment, and does need to be nerfed, all of it. In the beta test, you could count everyone who had composite armor on your fingers.

I dont think the devs realized EVERYONE would have a suit, and havea amcro to don it instantly during a fight.



_______
Cagno Kyraic
Teräs Käsi Master
Obi-Zem-Kenobi
Sat Jun 05, 2004 4:21 pm
#32


10 seconds per armor piece. Sounds fine to me. I love using armor macro's but hate the fact that this whole game has become a giant macro fest. If they continue to allow armor switching instantly then what is the point of having different kinds of armor with different strengths and weaknesses. You might as well have 1 suit of armor with no weaknesses and 90% to all things and call it good. They will continue to add "time sinks" to the game. They have to in order to set the proper pace. This is not a twitchy FPS (thats what JTLS is for). You fire your blaster based on speed of weapon, type of shot and your other speed bonuses. You don't shoot as fast as you can click your mouse button.. why should armor equipping be any different then the rest of the game? I could go on and on comparing the armor equiping delay to hundreds of other delays to prove my point but I am hoping most of us are smart enough to see that this just brings armor in line with other actions.


As for the reason this is being done when there are other more serious problems with the game: It's an easy fix that brings one part of the game closer to the vision of Galaxies that the Dev's and there bosses want. It also makes the game better.


Changes effect all of us in different ways, and some may not like it, but I hope they they bring it live and keep it there. Many parts of this game are far to easy and need some tweaking. This was one of them in my opinion.



Obi-Z
__________________________
"Meesah you Pappy!" -Darth Binks
SomeUser
Sat Jun 05, 2004 7:00 pm
#33




Obi-Zem-Kenobi wrote:



As for the reason this is being done when there are other more serious problems with the game: It's an easy fix that brings one part of the game closer to the vision of Galaxies that the Dev's and there bosses want. It also makes the game better.



The reason it is being done is so hybrid jedi dont macro armor on and off.


With the jedi revamp, Jedi can now progress up the jedi tree while retaining their old professions.. The more you advance up jedi the more SP you sacrifice....


However, you cannot use Force powers or Light Sabers with armor. To stop Jedi from macroing their armor off to use a Force Power or using their Light Saber only to then instant "re-armor" there is now a time delay.



This has NOTHING to do with making the game balanced for 99% of the player base or setting a "proper pace" nor does it have anything to do with realism.


Combat rebalance isnt coming until publish 11... The jedi have to get their lovin first ya know






Vezek


Obi-Zem-Kenobi
Sat Jun 05, 2004 9:04 pm
#34




Obi-Z
__________________________
"Meesah you Pappy!" -Darth Binks
Obi-Zem-Kenobi
Sat Jun 05, 2004 9:45 pm
#35

SomeUser wrote:
The reason it is being done is so hybrid jedi dont macro armor on and off.


sarcasmON Ummm ok .. so your saying this will only affect Jedi and not the rest of us? sarcasmOFF



SomeUser wrote:
However, you cannot use Force powers or Light Sabers with armor. To stop Jedi from macroing their armor off to use a Force Power or using their Light Saber only to then instant "re-armor" there is now a time delay.


sarcasmON Oh Thaaaaaaaaat Strategy... gosh.. of course.. flickering your armor on and off in between swinging your lightsaber, using your blaster and shooting force lightning on toads sarcasmOFF


Jedi won't need to mess with our silly mundane armor types anymore. They are getting Jedi robes that act as armor and let you use lightsabers and force powers!



SomeUser wrote:


This has NOTHING to do with making the game balanced for 99% of the player base or setting a "proper pace" nor does it have anything to do with realism.


sarcasmON [Ummm .. yeah how could stopping people from donning and removing entire suits of armor in the blink of an eye and causing them to have to take a few moments to put thing on and take them off make anything more realistic?] sarcasmOFF By adding the delay they ARE adjusting the pace!


-Z




Obi-Z
__________________________
"Meesah you Pappy!" -Darth Binks
Obi-Zem-Kenobi
Sat Jun 05, 2004 9:46 pm
#36

hmm seems like they disabled html tags for a while.. that must be to keep Jedi from being able to post using force powers...



Obi-Z
__________________________
"Meesah you Pappy!" -Darth Binks
Obi-Zem-Kenobi
Sun Jun 06, 2004 5:09 am
#37

Well NancyJ, It seems that I am not allowed to defend my position even when people make outrageously innaccurate claims. My point is simple. It is pretty narrow minded to assume that the only reason they do something is to nerf Jedi. It is pretty obvious this is a needed change and that Jedi are only one of the professions that is going to be affected by it. Anyone who uses armor like an on/off switch will be.


As far as you dictating what the point of this duscussion is.. well it has evolved and had evolved before I posted what I did.


I never said Jedi Robes would be better than composite. If you have any hard facts about what armor will be like after the reblancing I would love to see them because it is something of great interest to everyone involved.


Voke, I aplogized if I came off sounding harsh, but in my opinion, when you replied with big bold red words it seemed like you were coming down hard on me for my post.


-Z




Obi-Z
__________________________
"Meesah you Pappy!" -Darth Binks
SomeUser
Sun Jun 06, 2004 5:25 am
#38



Obi-Zem-Kenobi,


I apologizefor my big bold red letters. Players have a right to hold different opinions **even** when I feel very strongly that their position is wrong


I'm simply frustrated with the priorities. I know SOE needs to make money and Jedi is a major draw to gain new players... I also know, that they do need to revamp Jedi ASAP because the current system is ruining the gameplay (holo grinding)....


I just would have liked to see them not adding Jedi in the game in the first place until they had all the core profession fixed in the first place.


I feel that there are still some major issues with BE that need attention so when I heard that the Jedi profession is responsible for making my life a little harder Iacteddisproportionate to the armor macro.



NancyJ is correct though (as usual). This isnt about weather we agree with it or not. It is about how it effects us as BEs.


So, on that point:


1. It will effect my ability to sample while unbuffed.


ATM, without a doc buff I can sample relatively risk free all the creatures in SWG. There are many times when I dont have the time to play the game for several straight hours... So, I will log on and off through-out the day. It is nice to be able to log on Endor (for example), log back on several hrs later, and continue DNA sampling without having to worry about finding a Doc to buff... Since there are usually no docs 24/7 buffing on Endor (maybe that changed with the new bunker) I usually have to make a trip back to coronet to rebuff... Obviously this can mean a 10min wait to get to Coronet, several mins finding a doctor, several minutes in line, and 10 mins back to Endor... That a lot of wasted game time made all the worse when yo dont have time to play.


2. When they do nerf armor and buffs this will hit home even harder.


I made a MBE/TKM template because I didnt want to waste time always running from things that aggro me when sampling(especially the high-end stuff). Certain spawns/liars/missions will disappear/respawn if you run to far from them (sometime the respawn can be a good thing though).


Also, I dunno if this is just my imagination, but it seems critters chase you much further now...Iusually cant get aggro to break unless I'm almost over 180-220m from where they first aggroed me. That can add up to a lot of wasted time if a particular creature keeps aggroing you despite mask scent, +25 camo, and Java beer.



I agree with Nancy that it is "doubtful " they will remove this despite anything we say. It makes it all the harder to keep a reasonable demeanor


Anyhow, for what it is worth, that is how it will effect me as a MBE








Vezek


Seiryuu
Sun Jun 06, 2004 8:48 am
#39

ATM, without a doc buff I can sample relatively risk free all the creatures in SWG.

This pretty much sums up why this change is needed. This will force us to make hard decisions that make the game a challenge. Moreso for the combat professions.

If you want protection, wear the armor. If you want lower HAM costs, don't. The choice is yours. Which gives you the most benefit? I know they are buggy, but maybe you should invest in a few shield generators if you want the best of both worlds.

Armor which is mainly the domain of the combat professions. While we might care about it, the BE board is not going to change the armor system.

We should focus more on getting a resonable HAM cost that is in line with other professions rather than debate the merits of armor. Also don't forget the entire HAM system is changing with the combat balance. Our new ability pool is going to regenerate a lot faster, so it might not be an issue at all.



-----
Visit www.swgcreatures.com for all your creature needs.
Tell 'em Lantyssa sent you!

Math got you down? Need a tissue? Try my Chef and Tailor Tissue Calculators!

Looking for a special? Try this Excel spreadsheet on Special Abilities.
Page 3 of 5