Droid Engineer Archive

Thread: Droid Focus: TH's 19 Answers thread...(for my 1st question). (04/22/04)

AudioOrgana
Thu Apr 22, 2004 10:59 pm
#27











JediMindslayer wrote:
Actually, AudioOrgana sounds a wee bit too bitter to view the process objetively.






Well, that is your opinion. It's not about bitter, it's about experience and frustration watching people fall into the same pit of non-communicative discussion and wanting to get them to focus on what we know, not what we can imagine for the future that is past the space expansion. We have tons of current issues to talk about, and people talking about combat droids are taking away from the actual issues in-game right now. We all want them, in the future - but it is a mistake to be "proposing" anything now when there clearly will be no action taken for quite some time, and the criteria which that action will depend on haven't even been made yet.


Regardless, you are missing two key points :



  • In that simple question/answer forum, there is NO WAY we could have gotten an answer that would have satisfied anyone

  • The question has to do with something that is so far in the future it isn't even on a development schedule

My priorities are to see my profession be all that it has been promised to be since beta - and to have our question revolve around ANOTHER profession that will be potentially added to the game is silly, IMHO. When I gave those examples above, they were just that - I never said that any one specificly was a top priority. TK simply asked me for examples, and I gave them.


To be honest, I've read more about needing more than one droid out at once and other droid issues than those few vocal people who are rehashing combat droid discussions. Most of us are happy with the combat droids now, especially with post-Publish 8 HAM boosts.


You are right, people are starting to talk about combat proposals all over again - but if those people would just look at old posts in the DE forum you would see they are repeating themesleves or other people. Seriously, we have proposed every manner of combat proposal that could satisfy every bit of criteria.


Really, it's not worth the frustration of arguing about - you either have been here and seen this all happen before, or you haven't. I just see this as a wasted opportunity to get an answer to any number of questions that matter to us NOW, our time - you know, "Droid Invasion" and "Droids Rebuilt" - not an invitation for them to send us on a wild goose chase, again.


It doesn't matter how bad we want them - they are not coming any time soon. It's not like we could come up with some slam-bam proposal and it will appear in Publish 10. Droid Handler is six months to a year away - at the least. If DE's still have this as a current top priority, they aren't informed about the situation.


Call it bitter if you want, but that doesn't make me not right. I'm among less than a handful of veteran DE's who hasn't quit since Publish 7 hit, and if you want to ignore my experience go right ahead and waste nine months endlessly debating something that a) has already been discussed so many ways there is nothing new to be discussed, just rehashes, and b) has no effect on the Devs whatsoever when they clearly have a plan for a plain-jane Droid Handler profession that will be implemented when our punishment period is over.


Seriously, what is there to propose? It's going to be a new profession - they said no to EVERY hybird version.


So, you go and do that - and I will continue to try to bring light to the actual issues of the profession as we stand, not as some dim future possibility of an additional profession for us to serve. If the current issues are not taken care of, there will be no one to make those droids when the time comes.


There are no criteria - that is the answer to that question. People started asking that when they shot down Sodan's Hybird - but it was a rhetorical question, not a real one. They gave us the "criteria", and we satisfied it; ours wasn't implemented not because we didn't satisfy criteria that may or may not really exist, but because it wasn't a possibility in the first place. I know for an absolute fact that they offically considered the proposal out of courtesy, and nothing else; it was too late to make these publishes and the Devs were personally upset that we said "no DH" and suddenly we say we want them (failing, of course, to acknoledge that we didn't say we didn't want them, we said that we never said we "overwhelmingly wanted" them).


So the truth is there is no answer to that question. If that's your top priority in this profession, you are going to be disapointed for a very long time to come. The Devs didn't implement it because they didn't want to/couldn't, not because of "balance".


Again, as I said, that question was utterly useless, in all shapes and forms.


AO

Message Edited by AudioOrgana on 04-23-2004 02:34 AM

AudioOrgana
Thu Apr 22, 2004 11:00 pm
#28






Dyna_Jones wrote:

Why is no one a bit outraged about this clarification.






LadyLeala wrote:


DOES THE QUALITY OF THE ACTUAL CRAFTING STATION MODULE MAKE ANY DIFFERENCE ON THE CRAFTING PROCESS?

Can you please clarify that just a tad? Thanks very much!





Nope. It neither adds nor subtracts from the process.


Personally I thought crafting stations were one of the few things that experimentation actually mattered.







I already posted in the thread.


It's especially ironic that I believe not too long ago TH told us that it DID matter, and we finally get the proper answer from the Medic communities question.


Then again, maybe today's answer was wrong...


/shrug


AO

Gron_DM
Thu Apr 22, 2004 11:41 pm
#29

I dont think that it matter is AO's point, TK used that question as a primer not to get an answer at all but to make them know its our prime concern. I hate the situation of what DE has become for us long time people and sadly agree with most of AO's remark fromt he point of view of a realist, but i must comment that i TK is using every political leverage tool he can and doing the best job he can to be a solid representitive for our case. We all know that the devs avoid working on DE issues as they either: have little to no understand of where to start OR are so intimidated by what they must do to get us fixed that it has taken them this long to truely start and will take even longer before they are close to finishing. This last 2 patchs show that they do want to integrate droids more fully into the SWG experience ...but... the counterpoint is as AO is pointing out the devs really do not comunitcate as much as would be implied by there posts. So they use dodgy answers like TH used about DH/DC...i hate it too, there is no easy answer they really goofed up on DE from the get go and it has been a painful an rough path to walk there last 6 months...the simple truth is you can wait it out and keep trying or you can quit it (to maybe return..?). there is no middle path that is what makes this the most bitter thing of all. its like abad marriage you can stick it out thru the therapy/fixsor get a divorce.



Vilance -Retired from SWG
MDE for most of it, Guildleader as well
EGC Founding leader August 03
Corbantis
Founding Mayor Of Rhuidean, Tatooine
placed Nov 03.
Jenden
Fri Apr 23, 2004 6:04 am
#30






RandDarkstar wrote:

I just finished reading TH's responses to Week #1 questions. The question on droid crafting modules is scary. It sounds like all droids act as 0.00 crafting stations. That effectively makes them useless, as that number affects both assembly and experimentation. There would be absolutely no reason to use one if that's the case.


I really hope that this becomes a high priority in the top 5 list for DE's, because if what I read is correct....








All depends, Most of the people I know would much rather be out somewhere else crafting than stuck in their house/shop crafting. You can't pull a private crafting station around with you. Even if you do look at stats... I still haven't noticed a difference between my +40 crafting station and my droid. Whether there's a difference there or no, if its not enough to be noticeable it doesn't matter.



Jenden Morn - Master of Droids- Tarquinas
Droid Engineer Blue Glowy
Owner, Operator, and Founder of DarkStar Inc.
Groupy of the best band in the galaxy, Solar Flair
3D art of Jenden by Saeelwenea

Daker-Naritus
Fri Apr 23, 2004 8:44 am
#31










Jenden wrote:


All depends, Most of the people I know would much rather be out somewhere else crafting than stuck in their house/shop crafting. You can't pull a private crafting station around with you. Even if you do look at stats... I still haven't noticed a difference between my +40 crafting station and my droid. Whether there's a difference there or no, if its not enough to be noticeable it doesn't matter.





You know.... An easy solution would be to have devs add a real crafting station as a component for the droid crafting module, and then for the crafting module to take on the effectiveness rating of the craftingstation inserted.


Wait.....don't freak out yet. Yes I know that DE is already too dependent on other artisans for parts. However, consider this:


(1) I don't think that devs will ever give droid crafting modules effectiveness like architect made crafting stations have. It kills one of architects only viable products, which like DEs products is never really destroyed (Architects stay alive only through the fact that they have 3 viable products--houses, harvesters, crafting stations--and not every player has one yet). As Jenden said, why would anyone buy an architect crafting station if DEs could experiment and create a movable one just as good.


However, if you put crafting stations in droids as part of the crafting process, you get (1) continued, and probably improved (through DEs), demand for architect stations, and (2) improved demand for DE modules (because people will want movable good effectiveness crafting stations).


(2) There are lots of people who don't use droid crafting stations because they think that they are inferior to architect ones. TH just put gas on the fire of that concept. Crafting station usefulness is limited to these people, and I think it limits DE sales to some extent.


Additionally IMHO, crafting stations are almost an afterthought to a lot of droid purchases.Not all, but some. People want to buy a medical (for field healing) or combat droid, the DE says "hey you have some extra slots to fill, wanna crafting module too?" and the person says "sure, why not." However, now that droid buyers are forced to choose between combat modules and crafting modules in droids, I see crafting droid sales with craftign modules dropping off some. I see few people buying a seconddroid, in addition to their combat droid, just for the benefit of having a movable crafting station that is inferior to architect crafting station.


However, if you give DEs the ability to make and supply good effectiveness crafting stations...people will want them and will buy a second/third droid to have one.


(3) Expense. Yes, this would increase the cost of droid crafting modules, if you spring for the 43 effectiveness stations. However, worst case scenerio, you buy really cheap 0 effectiveness stations from an architect, and you are in the exact same situation as before...inferior crafting modules at about the same price.



Just a rambling thought...


Message Edited by Daker-Naritus on 04-23-2004 10:47 AM

Kollos
Fri Apr 23, 2004 8:45 am
#32






AudioOrgana wrote:





Jnath wrote:


But what he asked goes far beyond just the stupid droid handler crap. If we know the criteria that they will accept we can implement ideas that everyone agrees are the most important.





They already told us the criteria...and we met it.


And they said no.




In all seriousness, no we didn't. As much as everyone involved liked to repeatedly claim that the proposed hybrid planwas balanced, it wasn't. It didn't do any good for anyone to point that out, though, because any comments to that effect were simply shouted down by the overwhelming majority that wanted to believe that the hybrid proposal was going to work.



Kollos Orcslayer : Master Droid Engineer : Master Artisan

Droids by Kollos -840, 3980 Seacht, Naboo (NW of Keren)
Bounty Hunter Droids by Kollos 4924, 6107 550m SW of Kaadara
Vehicles and Master Artisan Components also available
paying 250k/point for Droid Assembly Skill Tapes, minimum of +4

TheRealTK421
Fri Apr 23, 2004 8:51 am
#33






Kollos wrote:


In all seriousness, no we didn't. As much as everyone involved liked to repeatedly claim that the proposed hybrid planwas balanced, it wasn't. It didn't do any good for anyone to point that out, though, because any comments to that effect were simply shouted down by the overwhelming majority that wanted to believe that the hybrid proposal was going to work.




Kollos,

Thanks for stating this. I think it really needs to be heard.

It's one of those situations where, faced with an uncomfortable truth (that it wouldn't fly), people preferred to believe the lie we created for ourselves (that it DID work).


Thus, we needed a way to get past that issue.

I'm beginning to think I should have just asked about Space...



/bow

Respectfully,






TheRealTK421 a.k.a. "Doughbacca"
SWG DE Correspondent
Co-Founding member of Ahazi DENet & SWG DEA (Droid Engineer Association)
"I think all right-thinking people in this country are sick and tired of being told that ordinary, decent people are fed up in this country with being sick and tired. ...I'm certainly not. And I'm sick and tired of being told that I am."


Kollos
Fri Apr 23, 2004 8:56 am
#34






AudioOrgana wrote:





Dyna_Jones wrote:

Why is no one a bit outraged about this clarification.






LadyLeala wrote:


DOES THE QUALITY OF THE ACTUAL CRAFTING STATION MODULE MAKE ANY DIFFERENCE ON THE CRAFTING PROCESS?

Can you please clarify that just a tad? Thanks very much!



Nope. It neither adds nor subtracts from the process.


Personally I thought crafting stations were one of the few things that experimentation actually mattered.






I already posted in the thread.


It's especially ironic that I believe not too long ago TH told us that it DID matter, and we finally get the proper answer from the Medic communities question.


Then again, maybe today's answer was wrong...






I have given up on relying on answers to this type of question. By "this type" I mean questions that we, the players, can answer for ourselves with a bit of testing.


Asking this type of question of the Devs/TH is just asking for them to do a tremendous amount of digging around in the code to find an answer that may very well not be accurate because they missed some other part of the code that affects it.


This particular question had already been answered on multiple occasions by people performing simple tests. A friend of mine did a 200-item test comparing a +42 architect crafting station to a -10 architect crafting station and found no statistically relevant difference. Regardless of what any dev tries to tell me, I'm going to believe that test because it is derived from actual game experience. The Dev/TH answer may be more technically correct, but if I can't see the difference in-game then the difference is irrelevant.


Should we have to do this kind of testing to get this information? No, of course not. But given past experience with SOE it is by far the best way to answer this type of question.



Kollos Orcslayer : Master Droid Engineer : Master Artisan

Droids by Kollos -840, 3980 Seacht, Naboo (NW of Keren)
Bounty Hunter Droids by Kollos 4924, 6107 550m SW of Kaadara
Vehicles and Master Artisan Components also available
paying 250k/point for Droid Assembly Skill Tapes, minimum of +4

ArdenStarmariner
Fri Apr 23, 2004 9:22 am
#35

Well, if the DEV's respond to the question, I think it will be something along the lines of the Seagull Policy. That's where they fly in, cover ideas and propsals with bird droppings, and then fly back out again with out any constructive feedback.

TK did ask the question that many DE's want to know the answer to. In that he did his job. But its unrealistic to expect that an answer will be given. So those opposed have a point in that it was a wasted question. I have no suggestion on who is right on this one. But I do have to agree that it would have been more effective to ask something else. What question, I don't know. Right now, I don't much care what question is asked or if they even answer it.

Further efforts by the DE community to suggest anything for CL20+ droids should be tabled. We might as well forget about it until the DEV's actually roll something out on their own if ever. So I propose that our policy as the DE community to be to wait until the DEV's put some disasterous form of CL20+ droids into production on their own without any feedback from us then shoot their solution full of holes. Think its only fair that we play the seagull game too after the feasco over Sodan's proposal. I expect that whatever they are back there cooking in secret will be even more unbalanced and unworkable than the hybrid solution. As far as I care, they can go right on doing whatever they are doing.

Appologies guys, but my apathy is talking here. Respond if you want to, but don't expect a reply. I don't much feel like debating issues here anymore.




Arden Starmariner - Master Jedi, Smugglers' Alliance Privateer Ace - Eclipse.
Nemok Starmariner - Elder Commando - Eclipse.
LonelyGhost
Fri Apr 23, 2004 9:27 am
#36

I'm one of the old-DE....jaded and bitter. I try to be "constructive", and I post less (and am using a different Station account now). But I sympathize with Audio and I agree on much of it, but ONE HUNDRED PERCENT in one thing she said, and I paraphrase:


It is a waste of your time to pose any further suggestions, plans, idea's, or proposals on ANYTHING regarding ANY kind of droid combat.


....bootless, counterproductive, disadvantageous,feckless, fruitless, futile, good-for-nothing, hopeless,impractical,ineffective, ineffectual, inept,meaningless, no good,pointless, profitless,purposeless,stupid,unproductive, unprofitable, unpurposed, unusable, unworkable, vain, valueless, waste,worthless....


They already have a half dozen good systems on which to *base* new combat droids. This is the reason why I pulled upa bunch of necro posts last week...I got tired of seeing the same requests for ideas asked for and everyone ignoring the FACT that we, as a community, have been doing just that for 9 months.


Better yet, I wish they would just FORGET combat droids for a long time, and fix the PERSISTENT bugs that have plagued us, and make the EXISTING profession more attractive. Look, you cant take a rotten apple and make a yummy apple pie. Even with the sugar and crast, and cinnimon, the fact remains that the apple is rotten. SOE needs to fix the Apple before dropping sugar all over it.


I love the new modules. No, some of them aren't quite what we wanted, but they are a great step in the right direction. Like TK said, and TH has also said, they will allow us to get tweaks and such later on which would NOT have happenned if they weren't in the game at all.


Forget about Combat droids. Enough of the game is centered on combat. Too much, really. There is an incredible and complex crafting/commerce side of this gaem that could stand some serious Dev attention. Let the kiddies quit because they cant be a super-god destroyer of worlds. How about appeasing the dedicated and long-term players a little more?


Its obvious Test Center is useless in many ways, but they do have their place. Many of the outright bugs are getting fixed, and this is good. What Test lacks is the *volume* of use. The fact is, that the Devs dont know what the real impact these modules will have in the game until they get to Live. A week or three after they go Live, the Devs will pull the Metrics, and start to base tweaks on the numbers they see. Too bad Character Copy isnt turned on..maybe some of the Volume testing could have been tested befroe Live.


Forget Combat droids. Lets focus instead on what makes us DROID ENGINEERS....and that is Droids. Crafting, delivery, storage, translators, maintenance, etc... The kiddies with their guns will get combat droids one day. We, as DE shoudl be focused on the WHOLE profession, and not just this small part. If the WHOLE profesion is brought up to snuff, then we ALL win.



Crys Akkori - Merchant Engineer
Veteren of SIN, IO, and XC - A Founder of Jaxian Bay
Elder DE, Architect, Artisan, Chef, Merchant

Vendor on Naboo at -7547 4635 (Fly in to Theed)

Crafters do have decay on resources. As we use it it GOES AWAY. And when it's gone, we have to get more. - Elekae
JediMindslayer
Fri Apr 23, 2004 12:09 pm
#37

Well, to be honest, i am not thrilled about the proposition of the DH-related question either, but
as one of my previous posts tries to explain is, that the implementation of every droid is fubar from
the get-go.

The devs basically said screw function, and made every single droid multi-purpose, only differing in
hitpoints and number of module useage... (surg/rep/pow droids excepted, but even those suck and are broken still)

I have proposed a complete re-write that would actually give MEANING to our class, and is not impossible to implement,
but whoever is in charge of the situation is too apathetic to clean up the mess they created out of apathy in the
first place.




GATCGATCGATCTCCCTTTCCTTTCAACGGCGGAAGTCATAATAAAGTAAGTGTTTCGGGTTGGGTCTAGAATGAGTATATC
AGATCTCCAGGAGGGAGCATTTCCATTAATGATCGGGTTATCGCCAATACCTCTAGTTATATATTACTCCATCGAGTGATCG
TTCAATACTCGATCGTAGACGTTAAGTCACGGAGTTTCTAGCACCAATTTCAATAATAGCTGAGGATACGAAGCAGCGAGGA
TAATTACCGGGAGGTATAGGATCGCCAAATAATCCTCTAGATTCTTACTCCTTTCCCTGGCGATCACCTAGATCGATCTCTA


Shian_Tavkin
Fri Apr 23, 2004 1:37 pm
#38

Hmm



Much there is to think about here.







Shian -- Master Droid Engineer/ Master Artisan
AudioOrgana
Fri Apr 23, 2004 2:02 pm
#39







Kollos wrote:





AudioOrgana wrote:





Jnath wrote:


But what he asked goes far beyond just the stupid droid handler crap. If we know the criteria that they will accept we can implement ideas that everyone agrees are the most important.





They already told us the criteria...and we met it.


And they said no.




In all seriousness, no we didn't. As much as everyone involved liked to repeatedly claim that the proposed hybrid planwas balanced, it wasn't. It didn't do any good for anyone to point that out, though, because any comments to that effect were simply shouted down by the overwhelming majority that wanted to believe that the hybrid proposal was going to work.





I'm sorry, but I just don't agree. I said we met their criteria, not that it was perfectly balanced.


This isn't about hybirds, because that is NOT going to happen no matter what. They NEVER were going to implement that plan even IF it was somehow magically balanced. They didn't have the time nor the want to do it after we said "no we didn't overwhelmingly say we wanted DH". I don't post private PM's like some people around here, so you will have to take my word for it. Or not. /shrug


The point is THEY HAVE EVERY TYPE OF COMBAT PROPOSAL AT THEIR DISPOSAL, AND IT IS AN UTTER WASTE OF TIME TO TRY TO DESIGN ANOTHER ONE FOR THEM WHEN WE KNOW FULL WELL THEY ARE NOT GOING TO USE IT NO MATTER WHAT, ESPECIALLY SINCE THEY *PAY* PEOPLE TO DO SO.


How much more frickin' clear can I be?


It would be like WS posting their question about designing a potential new Pistol profession - I'm sorry, I'm here to bea Droid Engineer, not a Combat Droid Profession Game Designer and I bet a lot of WS would be just as upset their question was wasted on a wishlist item and not something that truly mattered.


CL+20 combat droids are over right now. Until at least after Space. So I wish people would just get over it and try to salvage what's left of us instead of spending their time asking for the Devs for another helping of "What do you want..."


It's too bad that other people aren't realistic enough to see that, and instead hold on to a fantasy that we have no control over fufilling.


TK, you need to curb those CL+20 discussions by being honest and telling people how unlikely it will be they will be implemented in the anywhere near forseeable future. You need to direct people towards working on DROID ENGINEERING, not fantasy game design school. If you don't do this, you are only contributing to the probelm and making the situation much worse. You know full well it's not happening any time soon, and if people are talking a lot about it, it is your responsibility to be realistic with them and NOT encourage them to waste their time as you seem to want to do.


People keep arguing irrelevant details, when the fact remains : the question was about something post-space far into the future, and was something that couldn't possibly have been answered in that format (as ANYONE who has EVER read one of those "give me questions" posts would know). There is a long history with the "5" answer posts, and anyone thinking about it should have known that with 19, it would be even worse.


Can someone say either of those facts is NOT the case and know what they are talking about?


It's a shame that people are allowing themselves to get sucked into the "nine-month" plan again - because it keeps us from focusing on the real, tangible, active issues in our profession. It's too bad that so many people who cared about such things have left, and the people that seem to still be around are more interested in grandstanding and posturing about things long over with or waxing about some potential future that was supposed to be NOW. There are very, very few people fighting for Droid Engineering these days. It's really a sad state of affairs.


AO


Page 3 of 4