Droid Engineer Archive

Thread: medical module model

overbyte
Fri Apr 09, 2004 5:15 am
#1

I've been thinking about the idea of utility and getting more droid into swg and it occurs to me that the medical droid is the best model to base future modules on.


it gives a med person an extra 10% on their skills which makes it indispensible to both novices and masters but does not make it way too uber (1 b in uber people!!), allows them to store a few buff making items using the item storage module and has a food/chem crafting station to make them mobile.


If all of the eliteutility professions were looked at in this way (ie with the right droid they get an equivalent10% bonus to their primary skill - slicing for smugglers (or spice production but that seems less of a cool thing), +1 socket for tailors, +3-5% bonus on final armour builds, +10% max / min damage to weapons (or a reduction of 10% ham cost), 10% increase in mindbuffs fordancers,and so on...) we could end up with a great set of utility modules for our droids.


Intereseted to know what you guys think



Ullunt Bik'El - Jack of All Trades, Master of None
(-DxD-) :: Yavin :: Chalistra
Commando :: TKA :: Pistoleer :: Imperial Pilot [>O<] :: Forum Grinder

Ye though I walk throught the valley of the shadow of death, I will fear no evil
For I am the meanest mutha in the valley, and I carry a big flamer


JediMindslayer
Fri Apr 09, 2004 5:42 am
#2



overbyte wrote:
I've been thinking about the idea of utility and getting more droid into swg and it occurs to me that the medical droid is the best model to base future modules on.
it gives a med person an extra 10% on their skills which makes it indispensible to both novices and masters but does not make it way too uber (1 b in uber people!!), allows them to store a few buff making items using the item storage module and has a food/chem crafting station to make them mobile.
If all of the elite utility professions were looked at in this way (ie with the right droid they get an equivalent 10% bonus to their primary skill - slicing for smugglers (or spice production but that seems less of a cool thing), +1 socket for tailors, +3-5% bonus on final armour builds, +10% max / min damage to weapons (or a reduction of 10% ham cost), 10% increase in mind buffs for dancers, and so on...) we could end up with a great set of utility modules for our droids.
Intereseted to know what you guys think





Actually, this is wrong.

The current medical droids actually DECREASE effectiveness of healers unless it is the very best droid buildable (110% Medical)

So instead of healing 1000hp using a droid with (10% Medical), you would heal only 100hp....

Kinda sucks, but then so does everything lately.




GATCGATCGATCTCCCTTTCCTTTCAACGGCGGAAGTCATAATAAAGTAAGTGTTTCGGGTTGGGTCTAGAATGAGTATATC
AGATCTCCAGGAGGGAGCATTTCCATTAATGATCGGGTTATCGCCAATACCTCTAGTTATATATTACTCCATCGAGTGATCG
TTCAATACTCGATCGTAGACGTTAAGTCACGGAGTTTCTAGCACCAATTTCAATAATAGCTGAGGATACGAAGCAGCGAGGA
TAATTACCGGGAGGTATAGGATCGCCAAATAATCCTCTAGATTCTTACTCCTTTCCCTGGCGATCACCTAGATCGATCTCTA


overbyte
Sat Apr 10, 2004 4:27 pm
#3

yeah - that's what i meant - the level 6 version of stuff not only allows the skill to be used outside of it's natural environmentbut also gives a bonus.



Ullunt Bik'El - Jack of All Trades, Master of None
(-DxD-) :: Yavin :: Chalistra
Commando :: TKA :: Pistoleer :: Imperial Pilot [>O<] :: Forum Grinder

Ye though I walk throught the valley of the shadow of death, I will fear no evil
For I am the meanest mutha in the valley, and I carry a big flamer


Glantor
Sat Apr 10, 2004 11:42 pm
#4

I've got similar lines of thinking with regards to other profession modules


1) Slicing droid with the very best module allows a 10% increase in slicing ability (more uber slices!)
2) Ranged combat droid allows owner to hit 10% more accurately (no no no, aim higher you stupid biped!)
3) Scout droid allows 10% more harvested resources (better butcher, hehe)
4) BEs sample more and kill less (but but . . . I was just trying to get a DNA sample!)




Glantor Soulbearer (In Game Name)
Master Droid Engineer (Since December '03)
Glantor's Gallery at -4947, -5788 Tatooine, Sandstorm Metropolis
---------------------------------------------
Need a droid on Starsider? For the best custom droids that
won't burn a hole in your pocketbook, holomail glantor now!
FREE CONSULTATION AND ADVICE =)
overbyte
Mon Apr 12, 2004 3:28 am
#5

good call



Ullunt Bik'El - Jack of All Trades, Master of None
(-DxD-) :: Yavin :: Chalistra
Commando :: TKA :: Pistoleer :: Imperial Pilot [>O<] :: Forum Grinder

Ye though I walk throught the valley of the shadow of death, I will fear no evil
For I am the meanest mutha in the valley, and I carry a big flamer


Page 1 of 1
Previous Next