Droid Engineer Archive

Thread: Fire! Another use for the Hero of a Thousand Devices!

Drake_Khoren
Fri Oct 31, 2003 6:15 am
#1

Hi guys,


I'm no Droid Engineer but I do feel for your class and have some hope for you now that TH is on board and helping to set you all on the path of being fixed at long last!


That said, I've just been reading the "DE's: Two Questions" post that TH posted last night. One of the things many of you (and I) want is more usefulness for the different type of droids and this got me to thinking a little. Now, I used to play (still do, on occasion) the older version of the Star Wars trading card game and while reading I was put in mind of that and had an ideafora reallyuseful droid device. If you've already come up with this then apologies for repeating it, if you haven't - then maybe one of you can add it to the list of useful devices you'd like on droids for TH to see.


Fire extingushers!


When the idea popped into my head I really wondered why I hadn't thought of or seen it somewhere before. R2 uses one in the movies and there is currently no way to combat the commando fire-dot save jumping in the water. This one device alone would (in my opinion) be a massive selling point for the R2 unit to anyone involved in PvP or the GCW.Sure, commando's might cry a little (sorry guys) but they're a tough bunch (you'd think!) andI'm surethat giving one droid type the ability to put out the fire-dot wouldn't be massively unbalanced.


So what do you think? Good idea or terrible one? If you like it, I'll go and dig out the cards and see what other devices spring up as seemingly fit for use within SW:G!


Thanks for the input, hope you like the idea and looking forward tomany more droidsin the Star Wars Galaxiesuniverse!




/salute

Korla Kah'Ha.
Retired Major of the Imperial Army
Droid_Engineer_Rho
Fri Oct 31, 2003 6:44 am
#2

Works for me.



In fact, I'd love it if an R2 could put out the fire on a burning harvester, too!




Taking a well-deserved vacation from his successful Droid Engineering business, Master Rho can be found puttering around the galaxy.
Eutock
Fri Oct 31, 2003 7:36 am
#3

Great idea. It would be simultaneously hilarious and functional to see master commandos running around with astromechs tailing them to put out their next PvP fire.


And unlike, say, the MSE bomb idea in the official DE 'Plan', this one is incredibly consistent with Star Wars.


There is a sticky thread on the DE forum concerning new modules. I don't know if this idea is somewhere in there already, but you should cut & paste your idea into that thread.





Eutock of Radiant
July 5th, 2003 - August 4th, 2005

"I am not a droid engineer, but I used to play one in Star Wars Galaxies."

Drake_Khoren
Fri Oct 31, 2003 8:41 am
#4

Glad you like the idea!


I found the sticky thread just after I posted this so I added it in there as well.


Gonna go and see if I can find any more little idea's!


DK




/salute

Korla Kah'Ha.
Retired Major of the Imperial Army
Skippydsp
Fri Oct 31, 2003 8:42 am
#5

these are the kind of ideas that are


A) Fun


B) in the words of the Devs "star warsey"


C) the kind of idea what adds to the immersion factor of the game



these are the little things that could make this game even more of a blast.


Bravo!




--------------------------------------------
Jorran Gurn, Master Commando
/And\
Teso Gurn, Novice Droid Engineer
Member of the Head Council, Eternal Fury -=FURY=-
Drake_Khoren
Fri Oct 31, 2003 9:39 am
#6

Ok, been digging through my (rather TOO extensive) collection of trading cards and came up with a few more droid devices which I feel could be worked into the game. Some are already in use, others might depend on changes in other professions (the holoprojector). What I'd like from you guys is some expansion on my idea's or some new idea's on how to fit the following devices into Star Wars Galaxies.


All these devices are used by Artoo in the movies (I think!).



1) Retractable Arm: Small claw-like arm with approx 2kg lifting capacity and 85cm reach.


SW:G Use: Currently stuck for an idea. Got any?


2) Holoprojector: "Help me Obi-Wan. You are our only hope" - You know the one.


SW:G Use: Looking at this brings to mind the idea of Holodiscs that dancers/musicians once tipped as a way ofrecording their performances - possibly allowing people to heal BF in the field. Any other uses welcome. The holoprojector would allow the playback of such devices. I'm sure there are many more creative uses for such a device as well.


3) Droid Sensorscope: You know the one Artoo uses in the swamps on Dagobah?


SW:G Use: Hmm... some sort of navigational aid I would think, although unsure how to implement it exactly. Idea's welcome while I keep thinking.


4) R2 Sensor Array: Similar to the sensorscope, able to detect lifeforms.


SW:G Use: Tracking is the first thing that comes to mind (I'm a ranger). Give anyone with the droid a very limited capability to track (Maybe just 200m?) and/orallow rangers more specific information about the creatures on track (faction aligment and overt status for players, maybe allow the ranger to set a waypoint to a creature on track when accompianied by adroid with this device). More thought needed here for the differences and uses of 3) and 4).


5) Arc Welder: Just like the one in the starport has in game!


SW:G Use: I know this one has already been mentioned. A couple of possibilities come to mind. One is to somehow mix this with the repair droid idea to increase efficiency (when they're fixed). The other is to allow the droid to automatically attempt to stun any aggressor within melee range of it's master.


Note that some of these would be restricted to certain droid types.


While I'm at it, a quick note about the unused data-modules. I can understand why the devolpers don't want people to store extra missions and extra pets, but does it seem reasonable to allow them to be used to store extra waypoints? I like to waypoint just about every interesting thing I come across from battlefields to temples to caves, as well as all the good shops that I like to visit andI'm starting to run out of room in my datapad. I'd gladly pay for a droid that could hold another 10, 20, 50, 100 (or whatever) waypoints for me.



If you guys could throw me some more feedback on these with additional idea's, I think it'd be worth starting a new "Hero of a Thousand Devices" thread to list all the best module idea's and their practical uses in an easy to use format (that list up top is huge and not at all easy to wade through!).


Thanks for the help.


DK




/salute

Korla Kah'Ha.
Retired Major of the Imperial Army
Drake_Khoren
Fri Oct 31, 2003 9:47 am
#7

Ok, tell you what - I won't start a new post, but help me thrash these idea's out a bit further and I'll add them to the big list. From what I've heard Sintrosi's more than capable of compiling the best stuff from that list - so I just need some help refining these idea's before I add them on.


Thanks!




/salute

Korla Kah'Ha.
Retired Major of the Imperial Army
Ki-Odo
Fri Oct 31, 2003 10:11 am
#8

Fire extinguisher - nice, didn't think of that.


Retractable arm - good idea, but can't think of any uses. Well, many uses possible, just none applicable to the game that I can think of.


Holoprojector - Would give entertainers a new way to make money, by selling their recordings. Would also allow BF healing somewhere besides cantina (currently the most limited thing in the game as far as I know). Of course, give the entertainers UXP when their holo is used. Maybe just ent healing exp so they can't hand out a bunch of their holos and have other people grind their profession for them.


Sensorscope - possibly useable as an auto-surveyor? Would have the same interface as the standard survey, but the droid would do it for you. Maybe set it to re-check the resource while you're running, and give a new waypoint, so as to automate the process a little more.


Sensor Array - Already exists, but in useless form as a requirement for many droids. May need a new name so as not to confuse it with the above sensorscope: Bio Sensors? I love the idea of giving other players a limited ranger /areatrack. Although, I can see this upsetting a lot of rangers. Maybe find a way rangers could provide a component to make this work? Limit the device to creatures only, with possible NPC with a master DE/master Ranger team up.


Arc welder - Could definitely act as a repair helper. How about fixing a certain percentage of a broken harvester due to lack of maintenance? Maybe fix half of it so as to not waste as much money repairing it?


Data Modules - Allow waypoints. Allow a limited number of pets. Allow an extra mission or two. These honestly aren't very game imbalancing, just helpful tools. Limit pets to 5 above the limit per droid used? 1 or 2 extra missions, capped no matter how many droids used to prevent people going out with 12 missions.


Also:


Item storage- Raise the cap above 10. 25 perhaps?



I love most of the ideas floating around, but it's so hard to get it all together in one spot for TH to read.




Ki-Odo - Wookiee - Chilastra
Master Droid Engineer/Semi-Pistoleer

"Do, or do not. There is no try...unless trying to unlock the Force." - Yoda (I swear, that's how it really went)
OdoJob
Fri Oct 31, 2003 10:13 am
#9

FIRE EXTINGUSHER MODULE


One of the best ideas ive seen!


Gorganthoth can you add it to our list?


Drake_Khoren
Fri Oct 31, 2003 11:47 am
#10

Question: Do you think it'd be feasible to have droid components which would have different uses depending on the professions using them? And with multiple professions being able to use the same droid in a variety of different ways? Would this help or hinder you as a professions?


An example is the arc-welder. In a repair droid it increases the efficiency of the repair work done, when attacked it has a chance to auto-stun the aggressor of it's master, in an R2 unit it can be used by a smuggler to help slicing - giving an extra, say 5% to the maximum possible slice. It might even have other uses on top of that. A weaponsmith or armoursmith might gain an additional experiment point. Do you think this is workable? Reasonable?


Going back to the Bio-sensor. An idea from the ranger forum said that maybe it would show the number/quality of resource types on a creature before harvesting if used by a ranger/scout. Bio-Engineers may be able to utilise it in some way when collecting DNA samples (I know very little about BE's, so this may not be feasible).


The Sensorscope could be used by an artisan class to survey for them as mentioned in previous threads. Program the droid to find a specific resource and away it goes! It'd take longer than surveying yourself so wouldn't upset the balance and would either e-mail you a waypoint or save a waypoint in it's data-module (which will of course now be fixed to carry waypoints - although I still think allowing pets/missions is too much) before it returns to you/pre-designated waypoint (i.e. your home or shop). In the hands of a ranger that same sensorscope would be used to enhance tracking abilities (as previously discussed) or give very minor tracking to non-rangers.


The question is - is it feasible to think along these lines? I believe many of the wants and needs of the playerbase could be met without bombarding the developers or players with a million different modules, but still giving enough to keep the crafting interesting and diverse for the droid engineers themselves. Sure, there's a lot more potential for bugs at first - but that's what the test centre is for!


If TH or another dev happens to read this, or any of you with programming expertise for that matter, I'd be interested to know if you think the idea would be too complex or whether it might actually offer a simpler programming solution?


For everyone else, how many of the many module idea's listed in the sticky above could be covered in this way?


I'd love to know!


DK


By the way, I thought of a use for the claw as well! It can be used for sampling when attached to a droid with the sensorscope and item storage. So you send your droid out looking for a speciific resource and comes back with one unit and a waypoint for you!


What do you think?




/salute

Korla Kah'Ha.
Retired Major of the Imperial Army
LonelyGhost
Sun Apr 11, 2004 2:06 pm
#11

This could be pretty funny. And add to our profession.



Crys Akkori - Merchant Engineer
Veteren of SIN, IO, and XC - A Founder of Jaxian Bay
Elder DE, Architect, Artisan, Chef, Merchant

Vendor on Naboo at -7547 4635 (Fly in to Theed)

Crafters do have decay on resources. As we use it it GOES AWAY. And when it's gone, we have to get more. - Elekae
JediMindslayer
Sun Apr 11, 2004 8:41 pm
#12

Necropost.




GATCGATCGATCTCCCTTTCCTTTCAACGGCGGAAGTCATAATAAAGTAAGTGTTTCGGGTTGGGTCTAGAATGAGTATATC
AGATCTCCAGGAGGGAGCATTTCCATTAATGATCGGGTTATCGCCAATACCTCTAGTTATATATTACTCCATCGAGTGATCG
TTCAATACTCGATCGTAGACGTTAAGTCACGGAGTTTCTAGCACCAATTTCAATAATAGCTGAGGATACGAAGCAGCGAGGA
TAATTACCGGGAGGTATAGGATCGCCAAATAATCCTCTAGATTCTTACTCCTTTCCCTGGCGATCACCTAGATCGATCTCTA


LonelyGhost
Sun Apr 11, 2004 9:06 pm
#13






JediMindslayer wrote:
Necropost.





So? Still a good idea. Anything helps, right?



Crys Akkori - Merchant Engineer
Veteren of SIN, IO, and XC - A Founder of Jaxian Bay
Elder DE, Architect, Artisan, Chef, Merchant

Vendor on Naboo at -7547 4635 (Fly in to Theed)

Crafters do have decay on resources. As we use it it GOES AWAY. And when it's gone, we have to get more. - Elekae
Page 1 of 2
Previous Next